Título SISTEMA DE ESTABILIZACION DE PLASMIDOS PARA EL SUMINISTRO DE ANTIGENOS.
Clasif. 8 A01N63/00 (2006.01) ,C07H21/02 (2006.01) ,C07H21/04 (2006.01) ,C12N1/20 (2006.01) ,C12N15/00 (2006.01) ,C12N15/74 (2006.01) ,A61K39/02 (2006.01)
Resumen Vector de expresión que comprende una secuencia nucleotídica que codifica: un origen de replicación que confiere un número medio de copias que está comprendido entre 2 y 75, seleccionado de entre el grupo que consiste en: oriE1 (SEC ID nº.1), ori101 (SEC ID nº.3), ori15A (SEC ID nº.2) y sus derivados, y que está flanqueado en ambos extremos por terminadores de la transcripción; por lo menos una función de exterminio post-segregacional, seleccionada de entre el grupo que consiste en asd, ssb, phd-doc, kis-kid, y hok-sok, en la que la transcripción de flanqueo de los lugares que rodean dicha por lo menos una función post-segregacional es divergente y no perturbará significativamente los niveles de transcripción de tipo salvaje; y por lo menos una función de reparto seleccionada de entre el grupo que consiste en el lugar par de pSC101 y el parA de pR1, en la que la transcripción de flanqueo transcurre alejándose de dicha por lo menos una función de reparto; y un promotor ompC que comprende la siguiente secuencia: AGATCX1X2TAAX3CATCCACAGGAGGATATCTGATG (SEC ID nº: 36), en la que X1 se selecciona de entre el grupo que consiste en G, C y A; X2 es un inserto que tiene de 1 a 5 nucleótidos; y X3 se selecciona de entre el grupo que consiste en A, T, G y C.
Solicitante THE UNIVERSITY OF MARYLAND AT BALTIMORE
Direc. Soli. 520 W. LOMBARD STREET,BALTIMORE MARYLAND 21201-16
Nac.Solicitante US
Inventor GALEN, JAMES, E.
NºPublic. 2286905
F.Pub.Conce. 20071201
Prioridades US199812029809204117
US199910129960158738
Nº Solicitud Euro. E99964042
NºPubl.Euro. 1135025
F.Pub.Sol.Euro. 20010926
F.Conce.Euro. 20070425
Nº Solicitud PCT W9928499US
F.Sol. PCT 19991202
NºPubl.PCT W0032047
F.Pub.Sol.PCT 20000608
Países desig.PCT AT BE CH DE DK ES FR GB GR IT LI LU NL SE MC PT IE SI LT LV FI RO MK CY AL EPO
BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG OAPI
GH GM KE LS MW SD SL SZ TZ UG ZW ARIPO
AM AZ BY KG KZ MD RU TJ TM EAPO
Clasif.Principal A01N63/00,C07H21/02,C07H21/04,C12N1/20,C12N15/00